5 using a physical standby database with a time lag

Tài liệu Concepts and Administration pptx

Tài liệu Concepts and Administration pptx

Ngày tải lên : 17/01/2014, 06:20
... 10.9 Part II Using a Physical Standby Database with a Time Lag Establishing a Time Lag on a Physical Standby Database Failing Over to a Physical Standby Database with a Time Lag ... the standby database Similar to a primary database, a standby database can be either a single-instance Oracle database or an Oracle Real Application Clusters database A standby database can be ... either a physical standby database or a logical standby database: s Physical standby database Provides a physically identical copy of the primary database, with on disk database structures that are...
  • 474
  • 1.3K
  • 1
báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

báo cáo hóa học: " Onset and persistence of person-perceived participation restriction in older adults: a 3-year follow-up study in the general population" pptx

Ngày tải lên : 18/06/2014, 19:20
... by age, gender, educational attainment, occupational class and general health (using SF-12 physical and mental health scores), as those who did complete the three year follow-up questionnaire ... the attrition re-weighted analyses The observed data are available in additional file Observed onset and persistence of restriction in any and each aspect of life at three years Page of 11 (page ... Boutron I, Poiraudeau S, Ravaud P, Baron G, Revel M, Nizard R, et al.: Social and personal consequences of disability in adults with hip and knee arthroplasty A French national community based survey...
  • 11
  • 498
  • 0
Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc

Báo cáo lâm nghiệp: "Evaluation of squared timber and log products in the Hyrcanian Forests of Iran" doc

Ngày tải lên : 07/08/2014, 10:21
... Located in the northern part of Iran, the study areas are known as the Northern Forests or Hyrcanian Forests and are distributed across three provinces: Golestan, Mazandaran, and Gilan The majority ... monitored at the same time The relationships between squared timber and log products during the last 20 years (1989–2008) were evaluated using statistical software such as SPSS (Statistical Package ... and bucking operations are carried out by manual chainsaws; however, logs are extracted by skidders from forest stands to a yard near the main road (Fig 3) As K (2007) indicated, from 1997...
  • 6
  • 366
  • 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx

Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx

Ngày tải lên : 22/02/2014, 07:20
... ture at 2.8 A resolution of cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 12 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, ... supernatant after ultracentrifugation was loaded on the first column, a DEAE-Sepharose CL-6B (Pharmacia Biotech) equilibrated with 20 mM potassium phosphate pH 8.0, mM EDTA and 0.5 gÆL)1 dodecyl maltoside ... that both complexes display a basically similar line shape, and turnover numbers are in close agreement at 20 lM cytochrome c This behaviour is taken as a first evidence that the periplasmically...
  • 9
  • 457
  • 1
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Ngày tải lên : 07/03/2014, 14:20
... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... four mutants and the four corresponding alanine mutants The least active mutants (i.e the alanine mutants) were deliberately purified using a column (washed with our standard protocol) that had been...
  • 10
  • 651
  • 0
Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Báo cáo khoa học: Local changes in the catalytic site of mammalian histidine decarboxylase can affect its global conformation and stability pptx

Ngày tải lên : 08/03/2014, 08:20
... conformational change in aspartate aminotransferase after substrate binding, which promotes the catalytic reaction, as it favors maximum imine–pyridine conjugation Aspartate aminotransferase is also a ... M., Hara, M., Mai, L., Numayama-Tsuruta, K., Ishigaki-Suzuki, S., Ohuchi, K., Ichikawa, A. , Falus, A. , Watanabe, T & Nagy, A (2001) Mice lacking histidine decarboxylase exhibit abnormal mast cells ... Tanaka, S., Terni, T., Hori, Y., Makabe-kobayahi, Y., Pejler, G., Tchougonova, E., Hellman, L., Gutsenstein, M., Hirasawa, N., Sakurai, E., Buzas, E., Kovacs, P., Casaba, Gy, Kittel, A. , Okada,...
  • 12
  • 409
  • 0
Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Báo cáo khoa học: Kinetic and crystallographic analyses of the catalytic domain of chitinase from Pyrococcus furiosus – the role of conserved residues in the active site pdf

Ngày tải lên : 15/03/2014, 11:20
... TTACTTGGCATTTGACATAGAAGCC-3¢, 5¢-GCCACT TACTTGGACTTTAACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGACTTTGCGATAGAAGCCGG-3¢, 5¢-GGAC TTTGACATACAAGCCGGTATCGATGC-3¢, 5¢-GGACT TTGACATAGCGGCCGGTATCGATGC-3¢ and 5¢-GGA TCACTAGCCTTCGCGAGTGTAGACAGAG-3¢, ... B-factor values ˚ All atoms (A2 ) ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) ˚ Substrate (A2 ) ˚ Water (A2 ) R.m.s DB values ˚ Main-chain (A2 ) ˚ Side-chain (A2 ) Ramachandran plot statisticsf Favored (%) Allowed ... polymerase (TOYOBO, Osaka, Japan) Target primers for the generation of D522N, D52 2A, D524N, D52 4A, E526Q, E52 6A and W66 4A mutations were 5¢-GCCACT TACTTGAACTTTGACATAGAAGCCGG-3¢, 5¢-GCCAC TTACTTGGCATTTGACATAGAAGCC-3¢,...
  • 13
  • 514
  • 0
Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

Báo cáo khoa học: Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea potx

Ngày tải lên : 16/03/2014, 05:20
... of the ANME-1 cluster, there is a codon for a valine, whereas in mcrA from methanogenic archaea, there is a codon for a glutamine [2] 4914 Methanogenic archaea and methanotrophic archaea all belong ... essential in Methanosarcina acetivorans C 2A and allows isolation of mutants with defects in regulation of the methanol utilization pathway J Bacteriol 187, 5552–5559 14 Metcalf WW, Zhang JK, Apolinario ... Methanococcus voltae Methanoculleus thermophilus (MCR I) Methanosarcina barkeri Methanotrophic archaea of the ANME-1b cluster LGFYG*YDLQDQC*GASNSLSIRa LGFYG*YALQDQCGAANSLSVRa LGFYG*YDLQDQCGAANSLSFRb...
  • 9
  • 548
  • 0
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt

Ngày tải lên : 17/03/2014, 10:20
... 5¢-GTTCGAGAACAATGAATGTTGTGTTC-3¢ 5¢-GAACACAACATTCTCTGTTCTCGAACC-3¢ 5¢-GAAGTTAAAGATACAATGATTCAGCTC 5¢-CATTGTTGAAGACATCAATGTTG-3¢ 5¢-CTTTACATTGTTGAATTCATCAATGTTGCAGC-3¢ 5¢-CATTGTTGAAAACGCTAATGTTGCAG-3¢ ... 5¢-GATACCGATGAGATGGGTGGGCAGTTTAG-3¢ 5¢-CAACATTCCTTGTCATCGAACCAAACTC-3¢ 5¢-GAACACAACATTCATTGTTCTCGAAC-3¢ 5¢-GGTTCGAGAACAGAGAATGTTGTGTTC-3¢ 5¢-GAGCTGAATCATTGTAACTTTAACTTC-3¢ 5¢-CAACATTGATGTCTTCAACAATG-3¢ ... 5¢-CAACATTGATGTCTTCAACAATG-3¢ 5¢-GCTGCAACATTGATGAATTCAACAATGTAAAG-3¢ 5¢-CTGCAACATTAGCGTTTTCAACAATG-3¢ 5¢-CATACGGAGCATGAGGGTTTCCTTG-3¢ 5¢-CGGGATCGCCATTTCGAGACGGAGGG-3¢ 5¢-CGGGATCGCCATAAAGAGACGGAGGG-3¢ 5¢-GACTAGAAGCGGGAACGCCATACGGA-3¢...
  • 12
  • 380
  • 0
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx

Ngày tải lên : 17/03/2014, 17:20
... substrates with large, hydrophobic side chains (such as cephalosporin C and D-phenylalanine), as well as for a small and polar amino acid such as D-serine The Y238 mutants have a similar substrate ... assay and gel electrophoresis DAAO activity was assayed with an oxygen electrode at pH 8.5 and 25 C with 28 mM D-alanine as substrate at air oxygen saturation ([O2] 0.253 mM) [14] One DAAO unit ... with Y238F DAAO mutant, consistent with a ternary complex mechanism For Y238S, as well as for wild-type DAAO [24], a parallel line pattern in the secondary plots was found instead Such a behaviour...
  • 10
  • 496
  • 0
Report Development Tools Building Custom Reports in the R/3 System

Report Development Tools Building Custom Reports in the R/3 System

Ngày tải lên : 27/10/2013, 07:15
... of SAP AG SAP AG makes no warranties or representations with respect to the content hereof and specifically disclaims any implied warranties of merchantability or fitness for any particular purpose ... Giovannelli, and Patrick Zalamea (Ziatech Corporation) Pamela Anderson and Robert Smith (publishing consultants) Werner Aigner, Simone Baeumer, Tami Becker, Randi Bethel, Sylvia Chaudoir, Muge Das, ... Detailed Table of Contents Running an OIW Report With Automatic Update C–15 Running an OIW Report Without Automatic Update/Calculation C–17 Saving and Running an OIW Report as a...
  • 16
  • 657
  • 0
Fill in the gaps 3

Fill in the gaps 3

Ngày tải lên : 02/11/2013, 10:20
... such as 'isn't' and 'doesn't' k …materials such as nylon as well as natural materials such as cotton l …it is unlikely that man will be able travel to other galaxies Don't forget to keep a record ... suppress any newspaper reports which contain bad news 10 Examination candidates are not allowed to eat, drink, smoke or talk for the time / duration of the examination 11 The UK Government can decide ... teaching assistants in order to _ undergraduates a instruct b drill c inform 10 Cigarette packets on sale are required to carry a _ clearly stating the dangers of smoking a label...
  • 13
  • 650
  • 1
Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx

Tài liệu Personal Web Usage in the Workplace: A Guide to Effective Human Resources Management Part 3 docx

Ngày tải lên : 24/12/2013, 18:15
... exploratory factor analysis with varimax rotation was conducted on the 18 measures The factor analysis revealed four factors and explained 64.36% of the variance in the data Table shows the factor loadings ... company and other organizational leaders have a common understanding and agreement about the importance of trust, the nature of organizational trust, and an assessment of the climate of trust that ... observe their managers to see what is and is not acceptable behavior within an organizational setting It is important that managers accept and model appropriate Web use behavior congruent with Copyright...
  • 46
  • 562
  • 0
Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx

Tài liệu Color Atlas of Pharmacology (Part 3): Distribution in the Body docx

Ngày tải lên : 22/01/2014, 00:20
... substance and and Solid substance structurally bound water structurally bound water 40% 20% 40% intracellular intracellular water water extra-cellular extracellular water water Potential aqueous ... membranes of intracellular organelles (6) or are stored within the latter (7) In these cases, Vapp can exceed the actual size of the available fluid volume The significance of Vapp as a pharmacokinetic ... order to reach their sites of action, they must leave the bloodstream Drug permeation occurs largely in the capillary bed, where both surface area and time available for exchange are maximal (extensive...
  • 10
  • 475
  • 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Ngày tải lên : 16/02/2014, 09:20
... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...
  • 14
  • 635
  • 0
Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Tài liệu Báo cáo khoa học: Neuronal growth-inhibitory factor (metallothionein-3): evaluation of the biological function of growth-inhibitory factor in the injured and neurodegenerative brain pdf

Ngày tải lên : 16/02/2014, 15:20
... in AD There are numerous pathological hallmarks in AD that are commonly accompanied by neuronal alterations These physical alterations include aberrant neurite sprouting and significant neuronal ... Regulation of metallothionein-III (GIF) mRNA in the brain of patients with Alzheimer disease is not impaired Mol Chem Neuropathol 32, 101–121 17 Sogawa CA, Asanuma M, Sogawa N, Miyazaki I, Nakanishi ... injured and degenerative brain C Howells et al extracellular senile amyloid plaques These physical alterations are often accompanied by aberrant neurite sprouting and significant neuronal loss, particularly...
  • 9
  • 664
  • 0
Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Tài liệu Báo cáo khoa học: Activation loop 3 and the 170 loop interact in the active conformation of coagulation factor VIIa pdf

Ngày tải lên : 18/02/2014, 08:20
... the lack of a transmembrane region, i.e an inability to dramatically lower the Km, it cannot exert the same dramatic impact on FX activation When G372AFVIIa was bound to lipidated TF, FX activation ... by translumination using an AutoChemiSystem AC1 auto darkroom (UVP Inc., Upland, CA, USA) Carbamylation was carried out in the same buffer by incubating lm G37 2A- FVIIa, lm FVIIa, 500 nm G37 2A- FVIIa ... accession number 1j 8a) with Asn in this position, albeit with F,W angles far from the allowed Ramachandran region, are virtually identical to that of FVIIa Modelling of Ala372(223) into FVIIa...
  • 11
  • 619
  • 0
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Ngày tải lên : 19/02/2014, 16:20
... NADPH, and glutamate dehydrogenase were from Wako Pure Chemicals (Osaka, Japan); meat extract (Extract Ehlrich) was from Kyokuto Seiyaku Kogyo (Osaka, Japan); and pentafluorophenylhydrazine was from ... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4-amino-3-hydroxybenzoate ... Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol Microbiol Res 152, 33–38 10 Takenaka, S., Asami,...
  • 7
  • 613
  • 1
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc

Ngày tải lên : 19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... N A A A A A A A A A A S S S S S S S S S S C C C C C C C C C C T T T T T T T T T T T T T T T T T T T T N N N N N N N N N N AthalianaB 159 PativumB 159 SoleraceaB 159 159 NtabacumB A. thalianaA...
  • 8
  • 494
  • 0